Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr12 116930812 rs59169088 ACATGAGTCAGCAGAAGTCATCAGTCAGTAGAAAC A 2928082
chr12 116930812 rs67047256 ACATGAGTCAGCAGAAGTCATCAGTCAGTAGAAAC A 2928083
chr12 116930844 rs566181474 A C 2928084
chr12 116930878 rs184972268 A C 2928085
chr12 116930900 rs188909884 T C 2928086
chr12 116930975 rs575674878 T C 2928087
chr12 116931167 rs12372279 A G 2928088
chr12 116931182 rs566144632 G A 2928089
chr12 116931183 rs12372622 T C 2928090
chr12 116931199 rs375290001 ACTTT A 2928091

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results