EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr13:114831409-114831631]
Chromosome characteristics of ZZZ3[chr13:114831409-114831631]
Back to top
Enhancers possibly regulated by ZZZ3[chr13:114831409-114831631]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr13 114817695 114838385 enh3028
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Muscle (A673) Heart
chr13 114830489 114831626 vista17187
VISTA
SNP sites on ZZZ3[chr13:114831409-114831631]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr13 114831473 rs139380411 C T 3415193
chr13 114831514 rs61973918 T G 3415194
chr13 114831536 rs12585115 C T 3415195
chr13 114831574 rs7997426 C T 3415196
chr13 114831577 rs115138490 C G,T 3415197
chr13 114831610 rs71105236 G GCACATGAGGCTCTTTCCTC 3415198
Genes possibly regulated by ZZZ3[chr13:114831409-114831631]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr13:114831409-114831631]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results