EnhancerDB
  1. Home
  2. TFBS
  3. POLR2A[chr14:54833829-54834649]
Chromosome characteristics of POLR2A[chr14:54833829-54834649]
Back to top
Enhancers possibly regulated by POLR2A[chr14:54833829-54834649]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 54825505 54836095 enh30907
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Large Intestine Prostate (RWPE1) Esophagus Astrocyte Stomach Uterus Breast Muscle (Myotube) Neural Stem Cells (H9) Epithelial (MCF-7)
chr14 54833964 54834357 vista17821
VISTA
SNP sites on POLR2A[chr14:54833829-54834649]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 54833845 rs376132529 A G 3554216
chr14 54833914 rs369215722 G A 3554217
chr14 54833925 rs137992729 AC A 3554218
chr14 54833945 rs12893789 A C 3554219
chr14 54834146 rs549245137 G A 3554220
chr14 54834558 rs555995543 T C 3554221
chr14 54834565 rs577540403 G A 3554222
chr14 54834620 rs144949102 T TCATCAGAGTGTGAGGTACTCA,TCATCAGAGTGTGAGGTACTCACATCAGAGTGTGAGGTACTCA 3554223
Genes possibly regulated by POLR2A[chr14:54833829-54834649]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POLR2A[chr14:54833829-54834649]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results