EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr14:62025844-62026420]
Chromosome characteristics of ZBTB33[chr14:62025844-62026420]
Back to top
Enhancers possibly regulated by ZBTB33[chr14:62025844-62026420]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 62012585 62031906 enh3258
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Adrenal Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Spleen Liver (HepG2) Prostate (RWPE1) Heart
chr14 62026213 62026731 vista18033
VISTA
SNP sites on ZBTB33[chr14:62025844-62026420]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 62025905 rs555756484 A ATTTTTTTTTTTT 3591836
chr14 62025947 rs560310256 G A 3591837
chr14 62025989 rs57182968 T C 3591838
chr14 62025999 rs74864184 C T 3591839
chr14 62026102 rs59692667 C T 3591840
chr14 62026172 rs78359356 T C 3591841
chr14 62026176 rs554132263 T A,C 3591842
chr14 62026227 rs149575909 GAACCTTAGTTTCCTTGTCTGTAAAATTAAGA G 3591843
chr14 62026227 rs370926842 GAACCTTAGTTTCCTTGTCTGTAAAATTAAGA G 3591844
chr14 62026227 rs377161409 GAACCTTAGTTTCCTTGTCTGTAAAATTAAGA G 3591845
chr14 62026272 rs544090751 T C 3591846
chr14 62026292 rs75578069 A G 3591847
chr14 62026339 rs73314871 C A,T 3591848
chr14 62026391 rs189094705 T C 3591849
Genes possibly regulated by ZBTB33[chr14:62025844-62026420]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr14:62025844-62026420]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results