Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 74207978 rs575985950 G C 3656944
chr14 74208118 rs561169845 T C 3656945
chr14 74208148 rs192932391 G A 3656946
chr14 74208252 rs371291071 C T 3656947
chr14 74208341 rs59939420 C A 3656948
chr14 74208345 rs533217053 CGCTCCTCTGCAGGCTTCCGCA C 3656949

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results