EnhancerDB
  1. Home
  2. TFBS
  3. ZZZ3[chr14:74208236-74208672]
Chromosome characteristics of ZZZ3[chr14:74208236-74208672]
Back to top
Enhancers possibly regulated by ZZZ3[chr14:74208236-74208672]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 74205176 74254969 enh3322
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Lung (A549) Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr14 74208106 74208498 vista18417
VISTA
SNP sites on ZZZ3[chr14:74208236-74208672]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 74208252 rs371291071 C T 3656947
chr14 74208341 rs59939420 C A 3656948
chr14 74208345 rs533217053 CGCTCCTCTGCAGGCTTCCGCA C 3656949
chr14 74208571 rs75911058 T C 3656950
chr14 74208662 rs17782146 C G 3656951
chr14 74208670 rs80160896 C T 3656952
Genes possibly regulated by ZZZ3[chr14:74208236-74208672]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZZZ3[chr14:74208236-74208672]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results