Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 77584190 77597222 enh3338
chr14 77591216 77591790 vista18566

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 77591110 rs552895592 G A 3677499
chr14 77591125 rs1396236 A G,T 3677500
chr14 77591158 rs112159947 C G 3677501
chr14 77591214 rs111623958 C T 3677502
chr14 77591253 rs544408481 C T 3677503
chr14 77591272 rs1396235 C T 3677504
chr14 77591338 rs7140474 G C 3677505
chr14 77591353 rs2661819 G A 3677506
chr14 77591379 rs28453195 C T 3677507
chr14 77591436 rs150909496 C T 3677508
chr14 77591438 rs7140348 C T 3677509
chr14 77591503 rs536441466 G GGGAGGCCACGCGCGACGGCGTCGCAGCC 3677510
chr14 77591542 rs28409379 C G 3677511
chr14 77591546 rs80059350 C G 3677512
chr14 77591576 rs76261762 G C 3677513

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results