| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 77584190 | 77597222 | enh3338 |
|
|
| chr14 | 77591216 | 77591790 | vista18566 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 77591436 | rs150909496 | C | T | 3677508 | |
| chr14 | 77591438 | rs7140348 | C | T | 3677509 | |
| chr14 | 77591503 | rs536441466 | G | GGGAGGCCACGCGCGACGGCGTCGCAGCC | 3677510 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|