EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr15:63370771-63375782]
Chromosome characteristics of ZBTB33[chr15:63370771-63375782]
Back to top
Enhancers possibly regulated by ZBTB33[chr15:63370771-63375782]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 63362965 63392035 enh16219
Prostate (PC-3) Liver (HepG2) Brain (SK-N-SH) Large Intestine Astrocyte Bone (Osteoblast) Stomach Placenta Thyroid Uterus Pancreas (Panc1) Muscle (Myoblast) Spleen Muscle (Myotube) Neural Stem Cells (H9) Heart
chr15 63372629 63373133 vista20254
VISTA
SNP sites on ZBTB33[chr15:63370771-63375782]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 63370843 rs11071724 A G,T 4016825
chr15 63370860 rs185660353 T C 4016826
chr15 63370865 rs34955176 GA G 4016827
chr15 63370887 rs12903453 A G 4016828
chr15 63370888 rs180792406 A G 4016829
chr15 63371053 rs576744943 T G 4016830
chr15 63371081 rs186052073 A G 4016831
chr15 63371127 rs117685283 A G 4016832
chr15 63371220 rs11636105 G A 4016833
chr15 63371431 rs554711660 C T 4016834
chr15 63371540 rs142772639 T A 4016835
chr15 63371582 rs183929263 G A 4016836
chr15 63371615 rs2652808 G A 4016837
chr15 63371644 rs8032506 G A 4016838
chr15 63371804 rs113169162 G T 4016839
chr15 63372017 rs117027311 T A 4016840
chr15 63372064 rs183031255 C G 4016841
chr15 63372119 rs200547723 ATAAC A 4016842
chr15 63372180 rs149883367 T C 4016843
chr15 63372224 rs544773942 G A,T 4016844
chr15 63372327 rs7174174 T C 4016845
chr15 63372361 rs75819454 C A 4016846
chr15 63372375 rs78593171 G A,C 4016847
chr15 63372402 rs143852862 A G 4016848
chr15 63372477 rs2062728 G A 4016849
chr15 63372520 rs184304805 G A 4016850
chr15 63372610 rs187625404 T C 4016851
chr15 63372668 rs572215675 T C 4016852
chr15 63372724 rs143457992 A G 4016853
chr15 63372898 rs574494685 G C 4016854
chr15 63372920 rs146739052 C T 4016855
chr15 63372957 rs28735280 A G 4016856
chr15 63373122 rs111673004 G A 4016857
chr15 63373131 rs76329526 A T 4016858
chr15 63373329 rs2729806 T G 4016859
chr15 63373403 rs536801490 A G 4016860
chr15 63373429 rs151069758 C T 4016861
chr15 63373552 rs560141856 A G 4016862
chr15 63373569 rs116763076 G A 4016863
chr15 63373912 rs150202219 G A 4016864
chr15 63373942 rs2652807 G C 4016865
chr15 63373968 rs76518515 G A 4016866
chr15 63374054 rs560744145 A ACATGCAGACCACTTTTATACTG 4016867
chr15 63374127 rs2652806 C T 4016868
chr15 63374129 rs2652805 A G 4016869
chr15 63374162 rs558183890 T G 4016870
chr15 63374256 rs2652804 T C 4016871
chr15 63374289 rs2729805 A C 4016872
chr15 63374294 rs28656270 T C 4016873
chr15 63374511 rs551321374 G A 4016874
chr15 63374564 rs563550708 T TA 4016875
chr15 63374643 rs147111390 G T 4016876
chr15 63374677 rs2937855 G C 4016877
chr15 63374758 rs566131945 G A 4016878
chr15 63374792 rs71393124 T C 4016879
chr15 63374825 rs1027647 C A 4016880
chr15 63375065 rs143326662 C T 4016881
chr15 63375110 rs191030291 C A 4016882
chr15 63375129 rs148010996 C T 4016883
chr15 63375237 rs111857153 G C 4016884
chr15 63375330 rs551577608 G A,C 4016885
chr15 63375371 rs79615293 A G 4016886
chr15 63375416 rs118078473 T C 4016887
chr15 63375539 rs553558111 C G 4016888
chr15 63375600 rs183014292 T G 4016889
chr15 63375680 rs190071048 A G 4016890
Genes possibly regulated by ZBTB33[chr15:63370771-63375782]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr15:63370771-63375782]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results