EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr15:69090214-69094371]
Chromosome characteristics of ZBTB33[chr15:69090214-69094371]
Back to top
Enhancers possibly regulated by ZBTB33[chr15:69090214-69094371]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr15 69072185 69092337 enh16270
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Blood (T-cell) Stomach Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Large Intestine Esophagus Blood (GM12878) Placenta Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr15 69090153 69090340 vista20486
VISTA
SNP sites on ZBTB33[chr15:69090214-69094371]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr15 69090255 rs148108720 C T 4054990
chr15 69090386 rs371253887 A G 4054991
chr15 69090482 rs147238693 G A 4054992
chr15 69090524 rs143692244 C G 4054993
chr15 69090547 rs147220138 C T 4054994
chr15 69090636 rs150157078 ATTCAAAGT A 4054995
chr15 69090636 rs375790526 ATTCAAAGT A 4054996
chr15 69090727 rs139665061 G A 4054997
chr15 69090820 rs536166031 G GT 4054998
chr15 69090958 rs115959757 C T 4054999
chr15 69091040 rs192405940 C G 4055000
chr15 69091227 rs28489630 C T 4055001
chr15 69091356 rs529519717 C T 4055002
chr15 69091377 rs75191412 A G 4055003
chr15 69091389 rs116807535 T C 4055004
chr15 69091451 rs2958409 T A 4055005
chr15 69091458 rs2958408 T G 4055006
chr15 69091650 rs2958407 A T 4055007
chr15 69091841 rs190072826 A G 4055008
chr15 69091883 rs149716929 C T 4055009
chr15 69091979 rs145583401 G A 4055010
chr15 69092015 rs530139791 G A 4055011
chr15 69092137 rs532809351 C T 4055012
chr15 69092180 rs552930017 G A,T 4055013
chr15 69092240 rs148421769 A G 4055014
chr15 69092414 rs34514357 GT G 4055015
chr15 69092414 rs398027783 GT G 4055016
chr15 69092424 rs546065349 C A,T 4055017
chr15 69092457 rs575232999 G A 4055018
chr15 69092512 rs146410362 T C 4055019
chr15 69092515 rs530171858 G A 4055020
chr15 69092521 rs16952549 T C 4055021
chr15 69092610 rs532629265 C G,T 4055022
chr15 69092717 rs140802662 G A 4055023
chr15 69092778 rs34889703 GA G 4055024
chr15 69092778 rs374387248 GA G 4055025
chr15 69092812 rs185420545 G A 4055026
chr15 69092855 rs547213349 T G 4055027
chr15 69092900 rs539297098 G A 4055028
chr15 69092910 rs555942258 C T 4055029
chr15 69092961 rs575889465 T C 4055030
chr15 69093010 rs554512907 G C 4055031
chr15 69093016 rs11855767 G A 4055032
chr15 69093017 rs72229331 AGCTTGCAGTGAGCCGAGATCCCGCCACTGC A 4055033
chr15 69093062 rs540705513 G A 4055034
chr15 69093285 rs114045412 T C 4055035
chr15 69093323 rs548927463 G C 4055036
chr15 69093339 rs11396438 A AG 4055037
chr15 69093339 rs397934774 A AG 4055038
chr15 69093357 rs76111749 T C 4055039
chr15 69093365 rs116411075 G A 4055040
chr15 69093417 rs193276279 C G,T 4055041
chr15 69093559 rs147510889 A AAG,AAGAAG,AGA 4055042
chr15 69093600 rs118044330 A C 4055043
chr15 69093601 rs117659899 A T 4055044
chr15 69093629 rs140634869 T C 4055045
chr15 69093673 rs2958401 C G 4055046
chr15 69093855 rs563051359 C A 4055047
chr15 69093943 rs6494774 A G 4055048
chr15 69094044 rs77243084 G A 4055049
chr15 69094079 rs12904108 A T 4055050
chr15 69094158 rs10689979 T TCA 4055051
chr15 69094158 rs397752790 T TCA 4055052
chr15 69094207 rs115780816 G A 4055053
Genes possibly regulated by ZBTB33[chr15:69090214-69094371]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr15:69090214-69094371]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results