EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:27262833-27263361]
Chromosome characteristics of ZNF274[chr16:27262833-27263361]
Back to top
Enhancers possibly regulated by ZNF274[chr16:27262833-27263361]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 27262265 27268135 enh31750
Skin (Keratinocyte) Prostate (PC-3) Cervix (HeLa-S3) Prostate (RWPE1) Lung (PC-9) Esophagus Astrocyte Liver Bone (Osteoblast) Muscle (A673) Peripheral Blood (MM.1S) Adrenal Muscle (Myoblast) Breast Muscle (Myotube) Uterus Blood (T-cell)
chr16 27263252 27263592 vista22260
VISTA
SNP sites on ZNF274[chr16:27262833-27263361]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 27262843 rs4414501 G A 4394583
chr16 27262862 rs117649305 C T 4394584
chr16 27262889 rs4787944 G A 4394585
chr16 27262904 rs550292087 C T 4394586
chr16 27262959 rs78538629 T C 4394587
chr16 27263277 rs574523487 TCCTCAACGCAGGGAGGCTG T 4394588
chr16 27263327 rs189810704 T C 4394589
Genes possibly regulated by ZNF274[chr16:27262833-27263361]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:27262833-27263361]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results