EnhancerDB
  1. Home
  2. TFBS
  3. TCF7L2[chr16:88540424-88541215]
Chromosome characteristics of TCF7L2[chr16:88540424-88541215]
Back to top
Enhancers possibly regulated by TCF7L2[chr16:88540424-88541215]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88521345 88553535 enh4185
Bone Marrow (K562) Brain (SK-N-SH) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Liver Blood (T-cell) Lung Blood (OCI-LY7) Stomach Muscle (A673) Placenta Colon (HCT116) Blood (Karpas-422) Pancreas Thymus Heart
chr16 88540534 88540913 vista23499
VISTA
SNP sites on TCF7L2[chr16:88540424-88541215]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88540466 rs184905539 C T 4663872
chr16 88540582 rs369740494 C T 4663873
chr16 88540629 rs148084799 C T 4663874
chr16 88540662 rs35598617 G T 4663875
chr16 88540687 rs55868347 T C 4663876
chr16 88540694 rs61511948 A G 4663877
chr16 88540716 rs147247738 G A 4663878
chr16 88540728 rs80352278 G A 4663879
chr16 88540889 rs144947010 G A 4663880
chr16 88540940 rs546101220 C CCCGCCTCCTCCCATCCCTGGGCCGTGCAGGGCT 4663881
chr16 88541097 rs7196553 C G,T 4663882
chr16 88541110 rs9933167 T C 4663883
chr16 88541140 rs7196578 C T 4663884
chr16 88541166 rs147504550 A G 4663885
chr16 88541170 rs7188539 T C 4663886
chr16 88541205 rs545030839 G A 4663887
Genes possibly regulated by TCF7L2[chr16:88540424-88541215]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TCF7L2[chr16:88540424-88541215]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results