Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88521345 88553535 enh4185
chr16 88540534 88540913 vista23499

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88540687 rs55868347 T C 4663876
chr16 88540694 rs61511948 A G 4663877
chr16 88540716 rs147247738 G A 4663878
chr16 88540728 rs80352278 G A 4663879
chr16 88540889 rs144947010 G A 4663880
chr16 88540940 rs546101220 C CCCGCCTCCTCCCATCCCTGGGCCGTGCAGGGCT 4663881
chr16 88541097 rs7196553 C G,T 4663882
chr16 88541110 rs9933167 T C 4663883

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results