EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr16:88540754-88541073]
Chromosome characteristics of ZNF274[chr16:88540754-88541073]
Back to top
Enhancers possibly regulated by ZNF274[chr16:88540754-88541073]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 88521345 88553535 enh4185
Bone Marrow (K562) Brain (SK-N-SH) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Liver Blood (T-cell) Lung Blood (OCI-LY7) Stomach Muscle (A673) Placenta Colon (HCT116) Blood (Karpas-422) Pancreas Thymus Heart
chr16 88540534 88540913 vista23499
VISTA
SNP sites on ZNF274[chr16:88540754-88541073]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 88540889 rs144947010 G A 4663880
chr16 88540940 rs546101220 C CCCGCCTCCTCCCATCCCTGGGCCGTGCAGGGCT 4663881
Genes possibly regulated by ZNF274[chr16:88540754-88541073]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr16:88540754-88541073]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results