EnhancerDB
  1. Home
  2. TFBS
  3. ZNF143[chr16:89410718-89411144]
Chromosome characteristics of ZNF143[chr16:89410718-89411144]
Back to top
Enhancers possibly regulated by ZNF143[chr16:89410718-89411144]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 89410245 89452355 enh16906
Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Neural Stem Cells (H9) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr16 89410388 89410772 vista23565
VISTA
SNP sites on ZNF143[chr16:89410718-89411144]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89410991 rs145447517 GATA G 4675237
chr16 89411010 rs3096296 C A 4675238
chr16 89411134 rs199567923 CGAGGGCACGGGAGCACAGCG C 4675239
chr16 89411134 rs375117859 CGAGGGCACGGGAGCACAGCG C 4675240
Genes possibly regulated by ZNF143[chr16:89410718-89411144]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF143[chr16:89410718-89411144]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results