Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 89410991 rs145447517 GATA G 4675237
chr16 89411010 rs3096296 C A 4675238
chr16 89411134 rs199567923 CGAGGGCACGGGAGCACAGCG C 4675239
chr16 89411134 rs375117859 CGAGGGCACGGGAGCACAGCG C 4675240
chr16 89411173 rs111767678 C T 4675241
chr16 89411186 rs374297187 G A 4675242

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results