Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 49502285 49519023 enh48044
chr17 49513112 49513244 vista25144

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 49512745 rs193017818 C G 4929895
chr17 49512841 rs74895500 T C 4929896
chr17 49512842 rs35977951 A G 4929897
chr17 49512864 rs372988744 A ATATCAGCTGTGTCTAGGCAGCGG 4929898
chr17 49513006 rs7217756 G A 4929899
chr17 49513024 rs139945711 T TG 4929900
chr17 49513179 rs12450429 A G 4929901
chr17 49513353 rs7218271 G T 4929902

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results