Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 63547485 63553195 enh17309
chr17 63550809 63551200 vista25567

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 63550183 rs112076251 G A 4992304
chr17 63550186 rs571874877 A ACCTTCAGGGAAAGGAGGTGC 4992305
chr17 63550241 rs117481339 T C 4992306
chr17 63550358 rs536069281 CTCCTCT C 4992307
chr17 63550385 rs72856679 C T 4992308
chr17 63550543 rs146046642 G A 4992309
chr17 63550743 rs140083726 C T 4992310
chr17 63550797 rs9895291 C A,T 4992311
chr17 63550946 rs72856680 C T 4992312
chr17 63551053 rs191451193 G A 4992313

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results