Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 63547485 63553195 enh17309
chr17 63550809 63551200 vista25567

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 63551368 rs4790931 C A,G 4992314
chr17 63551384 rs4790930 C A 4992315
chr17 63551545 rs560030128 A G 4992316
chr17 63551554 rs541335759 G T 4992317
chr17 63551610 rs192775827 C G 4992318
chr17 63551611 rs556345535 CTTTAAAAGTGACATCCCAACCTGGTTGTCCT C 4992319
chr17 63551650 rs184807716 T G 4992320
chr17 63551689 rs371632096 G A 4992321
chr17 63551707 rs190176893 C T 4992322
chr17 63551765 rs59648516 A G 4992323
chr17 63551810 rs75574465 C T 4992324
chr17 63551948 rs72856681 G A 4992325

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results