EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr17:70423461-70424204]
Chromosome characteristics of ZNF274[chr17:70423461-70424204]
Back to top
Enhancers possibly regulated by ZNF274[chr17:70423461-70424204]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr17 70352230 70433435 enh4580
Brain (SK-N-MC) Astrocyte Colon (HCT116) Blood (Karpas-422) Pancreas Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673)
chr17 70423161 70423493 vista25813
VISTA
SNP sites on ZNF274[chr17:70423461-70424204]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr17 70423474 rs73995808 C T 5034240
chr17 70423479 rs113509604 T C 5034241
chr17 70423479 rs546427215 T TC 5034242
chr17 70423543 rs8066829 G A 5034243
chr17 70423546 rs8066831 G A 5034244
chr17 70423563 rs143101258 C A 5034245
chr17 70423577 rs147493043 A G 5034246
chr17 70423601 rs8068003 C T 5034247
chr17 70423734 rs75976160 C T 5034248
chr17 70423761 rs115552757 C A 5034249
chr17 70423837 rs190327546 G A,T 5034250
chr17 70423906 rs142546023 C CAG 5034251
chr17 70423910 rs11656751 G A 5034252
chr17 70423947 rs541575834 C G 5034253
chr17 70423969 rs373177141 T C 5034254
chr17 70424109 rs58819495 T C 5034255
chr17 70424122 rs374264554 A AAATGAGTTGATTCAACTAAATC 5034256
chr17 70424122 rs577853684 A AAATGAGTTGATTCAACTAAATC 5034257
Genes possibly regulated by ZNF274[chr17:70423461-70424204]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr17:70423461-70424204]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results