Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 858228 870935 enh86290
chr19 867005 867400 vista28114

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 867079 rs1651892 T A,C,G 5368670
chr19 867221 rs144457121 C CA 5368671
chr19 867233 rs377401546 AG A 5368672
chr19 867292 rs200071794 CGGGGGCCTTAAAGTGG C 5368673
chr19 867292 rs535625106 CGGGGGCCTTAAAGTGG C 5368674
chr19 867292 rs547315598 CGGGGGCCTTAAAGTGGGGGGGCCTTAAAGTGG C 5368675

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results