EnhancerDB
  1. Home
  2. TFBS
  3. ZBTB33[chr19:867334-868219]
Chromosome characteristics of ZBTB33[chr19:867334-868219]
Back to top
Enhancers possibly regulated by ZBTB33[chr19:867334-868219]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 858228 870935 enh86290
Colon (HCT116) Uterus Stomach
chr19 867005 867400 vista28114
VISTA
SNP sites on ZBTB33[chr19:867334-868219]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 867385 rs73492564 G A 5368676
chr19 867389 rs114289589 C T 5368677
chr19 867449 rs370557601 C T 5368678
chr19 867450 rs182504109 G A,T 5368679
chr19 867451 rs143931711 TCG T 5368680
chr19 867505 rs150156322 C T 5368681
chr19 867595 rs8105744 G A,C,T 5368682
chr19 867607 rs575915108 GGCAGAGACACAGAAACAGCAT G 5368683
chr19 867661 rs112061574 C T 5368684
chr19 867666 rs573448989 A G 5368685
chr19 867678 rs370817085 C T 5368686
chr19 867684 rs562620638 AACAAGGAGAGCACGCAGAG A 5368687
chr19 867697 rs180680089 C T 5368688
chr19 867698 rs138392000 G A,T 5368689
chr19 867724 rs567568220 C T 5368690
chr19 867735 rs1683593 A G 5368691
chr19 867774 rs1683592 G A 5368692
chr19 867791 rs147347173 G A 5368693
chr19 867834 rs112502061 A C 5368694
chr19 867872 rs34828577 G A 5368695
chr19 867893 rs185737415 G A 5368696
chr19 867906 rs190400796 G A 5368697
chr19 867946 rs367957533 C T 5368698
chr19 867955 rs116479143 C T 5368699
chr19 867974 rs572136187 G A 5368700
chr19 867975 rs182667690 G A 5368701
chr19 867988 rs117346489 C T 5368702
chr19 868002 rs117801197 C T 5368703
chr19 868031 rs113862234 C A,T 5368704
chr19 868057 rs186193269 C T 5368705
chr19 868061 rs200916270 C A,T 5368706
chr19 868083 rs143517669 C T 5368707
chr19 868089 rs375750252 G C 5368708
chr19 868096 rs200186933 G A,C 5368709
chr19 868105 rs146602511 G A,C 5368710
chr19 868108 rs147510499 C G,T 5368711
chr19 868115 rs13090 C G,T 5368712
chr19 868206 rs369102326 AGCTCT A 5368713
Genes possibly regulated by ZBTB33[chr19:867334-868219]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZBTB33[chr19:867334-868219]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results