EnhancerDB
  1. Home
  2. TFBS
  3. POL24H8[chr19:867377-867673]
Chromosome characteristics of POL24H8[chr19:867377-867673]
Back to top
Enhancers possibly regulated by POL24H8[chr19:867377-867673]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 858228 870935 enh86290
Colon (HCT116) Uterus Stomach
chr19 867005 867400 vista28114
VISTA
SNP sites on POL24H8[chr19:867377-867673]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 867385 rs73492564 G A 5368676
chr19 867389 rs114289589 C T 5368677
chr19 867449 rs370557601 C T 5368678
chr19 867450 rs182504109 G A,T 5368679
chr19 867451 rs143931711 TCG T 5368680
chr19 867505 rs150156322 C T 5368681
chr19 867595 rs8105744 G A,C,T 5368682
chr19 867607 rs575915108 GGCAGAGACACAGAAACAGCAT G 5368683
chr19 867661 rs112061574 C T 5368684
chr19 867666 rs573448989 A G 5368685
Genes possibly regulated by POL24H8[chr19:867377-867673]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POL24H8[chr19:867377-867673]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results