Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 2489063 rs12986362 C T 5384735
chr19 2489111 rs539171782 C A 5384736
chr19 2489189 rs557165931 G T 5384737
chr19 2489362 rs553830828 TCGGGCACTGCGCCAGGGCC T 5384738
chr19 2489381 rs540484738 C T 5384739

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results