EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:4968337-4971772]
Chromosome characteristics of ZNF274[chr19:4968337-4971772]
Back to top
Enhancers possibly regulated by ZNF274[chr19:4968337-4971772]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 4966316 4995955 enh4974
Liver Astrocyte Colon (HCT116) Adrenal Blood (Karpas-422) Pancreas Uterus Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Thyroid Thymus Prostate (PC-3) Cervix (HeLa-S3) Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
chr19 4970760 4971027 vista28372
VISTA
SNP sites on ZNF274[chr19:4968337-4971772]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 4968616 rs376197499 G C 5404996
chr19 4968620 rs67625472 T C 5404997
chr19 4968820 rs375467195 G A 5404998
chr19 4968996 rs553795320 C A,G 5404999
chr19 4969053 rs57070985 A G 5405000
chr19 4969102 rs59562763 G GC 5405001
chr19 4969134 rs542159835 C A 5405002
chr19 4969182 rs547421839 C A 5405003
chr19 4969199 rs58324296 A C 5405004
chr19 4969268 rs533272472 C A 5405005
chr19 4969313 rs550215431 G T 5405006
chr19 4969505 rs537999307 G T 5405007
chr19 4969662 rs529293869 G GA 5405008
chr19 4969708 rs534067393 T C 5405009
chr19 4969726 rs368918480 AG A 5405010
chr19 4969731 rs182005498 G A 5405011
chr19 4969798 rs2271451 C G,T 5405012
chr19 4969799 rs576051278 T C 5405013
chr19 4969879 rs561929649 G A 5405014
chr19 4969897 rs559841807 C G,T 5405015
chr19 4969908 rs73536534 A G 5405016
chr19 4969960 rs190134083 C A 5405017
chr19 4970048 rs11879865 G A 5405018
chr19 4970098 rs539463878 A G 5405019
chr19 4970108 rs555875788 C A 5405020
chr19 4970368 rs578186270 C G 5405021
chr19 4970458 rs73536536 C T 5405022
chr19 4970465 rs141383674 G C 5405023
chr19 4970474 rs72988139 A G 5405024
chr19 4970593 rs12609484 G T 5405025
chr19 4970723 rs528694087 ACGGGGTCAGCCTTCTCCTGCAGCCCCTGCTGAAG A 5405026
chr19 4970810 rs7255772 C T 5405027
chr19 4970952 rs189893296 C T 5405028
chr19 4971026 rs117921451 G A 5405029
chr19 4971311 rs147183693 C T 5405030
chr19 4971407 rs533273520 T C 5405031
chr19 4971416 rs140410229 T G 5405032
chr19 4971430 rs201042327 TCTC T 5405033
chr19 4971430 rs867382079 TCTC T 5405034
chr19 4971440 rs149680147 T G 5405035
chr19 4971452 rs3835167 C CCT 5405036
chr19 4971561 rs17364488 G A 5405037
chr19 4971725 rs117551005 C T 5405038
Genes possibly regulated by ZNF274[chr19:4968337-4971772]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 4969125 5153606 + KDM4B ENSG00000127663.10 4969125 0.71 1.0 788 16856
Expression level of Genes
Back to top
miRNAs possibly regulated by ZNF274[chr19:4968337-4971772]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results