Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 5338459 5338816 vista28388

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 5338010 rs112772146 G A,C 5408694
chr19 5338113 rs201115332 C CG 5408695
chr19 5338114 rs199658055 C CG 5408696
chr19 5338179 rs34907337 A G 5408697
chr19 5338253 rs75853641 G C 5408698
chr19 5338345 rs561397172 G GTGGCCCCCAGGGGGCTGGGAGGCC 5408699
chr19 5338447 rs140199143 G A,T 5408700
chr19 5338524 rs566676343 G C,T 5408701
chr19 5338529 rs8106914 G A,T 5408702
chr19 5338540 rs552292800 A G 5408703
chr19 5338713 rs79622411 A C 5408704
chr19 5338738 rs534244906 G A 5408705
chr19 5338756 rs73532996 C A 5408706
chr19 5338805 rs117378260 G C,T 5408707
chr19 5338811 rs80125132 A C 5408708
chr19 5338812 rs12984779 T C 5408709
chr19 5338851 rs137951097 G A 5408710
chr19 5338975 rs12985118 T C 5408711
chr19 5339086 rs562428650 G C 5408712
chr19 5339203 rs529295254 CG C 5408713

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr19 5158506 5340814 - PTPRS ENSG00000105426.10 5340814 0.7 1.0 1510 16857


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results