Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 10720517 10735795 enh17916
chr19 10728527 10728590 vista28596

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 10728030 rs8106664 G T 5437802
chr19 10728117 rs369674629 GTGTATGCCAGGCACCTCTCTC G 5437803
chr19 10728154 rs114888011 A G 5437804
chr19 10728167 rs115445672 G A 5437805
chr19 10728285 rs73923264 T C 5437806
chr19 10728320 rs2043305 A G 5437807
chr19 10728330 rs73923265 C T 5437808
chr19 10728415 rs183320093 A C 5437809
chr19 10728438 rs545972528 C T 5437810
chr19 10728491 rs188013027 T C 5437811

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results