EnhancerDB
  1. Home
  2. TFBS
  3. ZNF274[chr19:13162431-13165455]
Chromosome characteristics of ZNF274[chr19:13162431-13165455]
Back to top
Enhancers possibly regulated by ZNF274[chr19:13162431-13165455]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr19 13160145 13191995 enh17930
Astrocyte Colon (HCT116) Pancreas Uterus Kidney Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Pancreas (Panc1) Prostate (PC-3) Large Intestine Esophagus Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Lung Muscle (A673) Heart
chr19 13163511 13167355 vista791
VISTA
chr19 13164647 13164970 vista28684
VISTA
SNP sites on ZNF274[chr19:13162431-13165455]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr19 13162492 rs142154047 C T 5448414
chr19 13162573 rs538530007 A G 5448415
chr19 13162672 rs578012374 GGGGCGGCTCCCGGGAGCAGCC G 5448416
chr19 13162698 rs538046398 G A 5448417
chr19 13162755 rs528021457 G A 5448418
chr19 13162891 rs11881245 C A 5448419
chr19 13163026 rs78426335 C T 5448420
chr19 13163160 rs144213688 C T 5448421
chr19 13163167 rs60763576 G A 5448422
chr19 13163204 rs543668116 C T 5448423
chr19 13163515 rs77679906 T C 5448424
chr19 13163544 rs141103021 T C 5448425
chr19 13163557 rs112429723 ACGGCT A 5448426
chr19 13163576 rs10410538 G A 5448427
chr19 13163677 rs192384071 C A 5448428
chr19 13163722 rs150281756 C T 5448429
chr19 13163737 rs76833838 G A 5448430
chr19 13163771 rs138943008 A G 5448431
chr19 13163963 rs148988672 G A 5448432
chr19 13164028 rs75390960 G A 5448433
chr19 13164163 rs138740930 A T 5448434
chr19 13164185 rs539169338 AT A 5448435
chr19 13164187 rs547194551 T A 5448436
chr19 13164251 rs142738158 G A 5448437
chr19 13164326 rs548245873 G A 5448438
chr19 13164521 rs374500689 AC A 5448439
chr19 13164581 rs137945927 C G 5448440
chr19 13164595 rs141626046 C G 5448441
chr19 13164963 rs74748217 C T 5448442
chr19 13165193 rs117712228 C T 5448443
chr19 13165222 rs116767742 G C 5448444
chr19 13165397 rs60504074 G A 5448445
Genes possibly regulated by ZNF274[chr19:13162431-13165455]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF274[chr19:13162431-13165455]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results