EnhancerDB
  1. Home
  2. TFBS
  3. STAT3[chr2:26231804-26232231]
Chromosome characteristics of STAT3[chr2:26231804-26232231]
Back to top
Enhancers possibly regulated by STAT3[chr2:26231804-26232231]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 26217845 26245475 enh18363
Bone Marrow (K562) Liver Astrocyte Colon (HCT116) Adrenal Pancreas Uterus Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
chr2 26231667 26232185 vista30744
VISTA
SNP sites on STAT3[chr2:26231804-26232231]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 26231809 rs534252816 G GCAAATTTCCCAGGCAAATAGTACCAGCTTCAGGTACTATTCC 5596986
chr2 26232057 rs11894513 A G 5596987
chr2 26232063 rs529211710 G A 5596988
chr2 26232087 rs189096884 T A 5596989
Genes possibly regulated by STAT3[chr2:26231804-26232231]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by STAT3[chr2:26231804-26232231]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results