EnhancerDB
  1. Home
  2. TFBS
  3. ZNF217[chr2:101944357-101944551]
Chromosome characteristics of ZNF217[chr2:101944357-101944551]
Back to top
Enhancers possibly regulated by ZNF217[chr2:101944357-101944551]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 101942285 101952135 enh18760
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Epithelial (MCF-7) Large Intestine Blood (T-cell) Esophagus Astrocyte Liver Stomach Placenta Breast Muscle (Myoblast) Pancreas Neural Stem Cells (H9) Thymus Heart
chr2 101944459 101944757 vista32493
VISTA
SNP sites on ZNF217[chr2:101944357-101944551]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 101944400 rs73943450 C T 5919127
chr2 101944417 rs150163779 G A 5919128
chr2 101944533 rs371443609 C CGGAGATGATTATGGAGCCAT 5919129
chr2 101944533 rs565575790 C T 5919130
Genes possibly regulated by ZNF217[chr2:101944357-101944551]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF217[chr2:101944357-101944551]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results