EnhancerDB
  1. Home
  2. TFBS
  3. GATA2[chr2:232229633-232230547]
Chromosome characteristics of GATA2[chr2:232229633-232230547]
Back to top
Enhancers possibly regulated by GATA2[chr2:232229633-232230547]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr2 232224984 232232485 enh19319
Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-MC) Large Intestine Brain (SK-N-SH) Astrocyte Muscle (A673) Placenta Lung (PC-9) Pancreas (Panc1) Neural Stem Cells (H9) Epithelial (MCF-7)
chr2 232229850 232230117 vista35150
VISTA
SNP sites on GATA2[chr2:232229633-232230547]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr2 232229740 rs1551152 T C 6434566
chr2 232229989 rs12478052 G A 6434567
chr2 232230051 rs61412468 G A,C 6434568
chr2 232230129 rs140184883 A C 6434569
chr2 232230249 rs544395926 G T 6434570
chr2 232230259 rs149461976 G A 6434571
chr2 232230350 rs73098126 G C 6434572
chr2 232230359 rs550299061 GGCAGATAGGAACCAGCCGCACACACA G 6434573
chr2 232230392 rs28667919 G A 6434574
chr2 232230422 rs73098127 C A 6434575
chr2 232230518 rs372590301 C CT 6434576
chr2 232230518 rs577587622 C CT 6434577
Genes possibly regulated by GATA2[chr2:232229633-232230547]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by GATA2[chr2:232229633-232230547]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results