EnhancerDB
  1. Home
  2. TFBS
  3. CTCF[chr3:125986164-125986797]
Chromosome characteristics of CTCF[chr3:125986164-125986797]
Back to top
Enhancers possibly regulated by CTCF[chr3:125986164-125986797]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 125975545 125994175 enh20889
Cervix (HeLa-S3) Brain (SK-N-MC) Prostate (RWPE1) Astrocyte Bone (Osteoblast) Lung Blood (OCI-LY7) Stomach Muscle (A673) Placenta Colon (HCT116) Embryonic Stem Cell Line (H1-hESC) Pancreas Uterus Heart
chr3 125986265 125986571 vista42283
VISTA
SNP sites on CTCF[chr3:125986164-125986797]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 125986200 rs530452715 CGGCTCAGGGATCCCAGGCTGT C 7007662
chr3 125986248 rs111358401 T A 7007663
chr3 125986473 rs147334777 G A 7007664
chr3 125986588 rs74387581 G A 7007665
chr3 125986641 rs538506598 G T 7007666
chr3 125986769 rs140897420 C T 7007667
chr3 125986791 rs1447655 C T 7007668
Genes possibly regulated by CTCF[chr3:125986164-125986797]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by CTCF[chr3:125986164-125986797]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results