EnhancerDB
  1. Home
  2. TFBS
  3. GATA2[chr6:137082640-137083190]
Chromosome characteristics of GATA2[chr6:137082640-137083190]
Back to top
Enhancers possibly regulated by GATA2[chr6:137082640-137083190]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr6 137070385 137098975 enh23651
Bone Marrow (K562) Brain (SK-N-MC) Astrocyte Adrenal Pancreas Uterus Blood (T-cell) Kidney Epithelial (MCF-7) Stomach Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Peripheral Blood (MM.1S) Neural Stem Cells (H9) Thymus Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Muscle (Myoblast) Lung Heart
chr6 137082760 137083090 vista53682
VISTA
SNP sites on GATA2[chr6:137082640-137083190]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr6 137082683 rs75240027 C A 9365593
chr6 137082724 rs147133632 T C 9365594
chr6 137082739 rs73564030 G A 9365595
chr6 137082826 rs140330245 C T 9365596
chr6 137082929 rs184211338 A G 9365597
chr6 137082948 rs6924387 A G 9365598
chr6 137083030 rs115441805 T C 9365599
chr6 137083138 rs932589 C T 9365600
chr6 137083146 rs550917872 CACCAACCAAATATTAGAAA C 9365601
chr6 137083168 rs554065125 G A 9365602
chr6 137083169 rs571075516 G A 9365603
Genes possibly regulated by GATA2[chr6:137082640-137083190]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by GATA2[chr6:137082640-137083190]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results