EnhancerDB
  1. Home
  2. TFBS
  3. POLR2A[chr7:74073903-74074677]
Chromosome characteristics of POLR2A[chr7:74073903-74074677]
Back to top
Enhancers possibly regulated by POLR2A[chr7:74073903-74074677]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 74068285 74082061 enh9866
Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Lung (PC-9) Esophagus Astrocyte Bone (Osteoblast) Lung (A549) Blood (GM12878) Muscle (A673) Placenta Stomach Uterus Blood (Karpas-422) Embryonic Stem Cell Line (H1-hESC) Pancreas Pancreas (Panc1) Neural Stem Cells (H9) Blood (T-cell) Heart
chr7 74074203 74074528 vista56292
VISTA
SNP sites on POLR2A[chr7:74073903-74074677]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 74073955 rs6955845 C G 9893951
chr7 74074046 rs587686600 A T 9893952
chr7 74074080 rs587742159 C G 9893953
chr7 74074119 rs59377175 C T 9893954
chr7 74074213 rs587734470 G T 9893955
chr7 74074426 rs587739034 ATCTTGGTCTTTTGGCTGGAATGACATTTTTCAGCCTATGGAAATCTT A 9893956
chr7 74074512 rs202212853 T C 9893957
Genes possibly regulated by POLR2A[chr7:74073903-74074677]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POLR2A[chr7:74073903-74074677]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results