EnhancerDB
  1. Home
  2. TFBS
  3. REST[chr7:105705202-105705706]
Chromosome characteristics of REST[chr7:105705202-105705706]
Back to top
Enhancers possibly regulated by REST[chr7:105705202-105705706]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 105686265 105718733 enh9968
Brain (SK-N-MC) Astrocyte Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Lung Muscle (A673) Heart
chr7 105705488 105705603 vista56859
VISTA
SNP sites on REST[chr7:105705202-105705706]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 105705222 rs145773264 TCCAAATCGGAACCCAGATTTATTGGACC T 10006720
chr7 105705222 rs370421743 TCCAAATCGGAACCCAGATTTATTGGACC T 10006721
chr7 105705445 rs7787222 C T 10006722
chr7 105705512 rs141356972 G C 10006723
Genes possibly regulated by REST[chr7:105705202-105705706]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by REST[chr7:105705202-105705706]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results