EnhancerDB
  1. Home
  2. TFBS
  3. POLR2A[chr7:105705241-105706688]
Chromosome characteristics of POLR2A[chr7:105705241-105706688]
Back to top
Enhancers possibly regulated by POLR2A[chr7:105705241-105706688]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr7 105686265 105718733 enh9968
Brain (SK-N-MC) Astrocyte Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Ovary Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Prostate (RWPE1) Lung Muscle (A673) Heart
chr7 105705488 105705603 vista56859
VISTA
SNP sites on POLR2A[chr7:105705241-105706688]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr7 105705445 rs7787222 C T 10006722
chr7 105705512 rs141356972 G C 10006723
chr7 105705745 rs113480876 G T 10006724
chr7 105705765 rs550886784 TCCTCTGGTTCTGCACTGACCTGC T 10006725
chr7 105705802 rs2107706 C G,T 10006726
chr7 105705913 rs188968599 T C 10006727
chr7 105705919 rs79206603 T C 10006728
chr7 105706047 rs115351385 C A,G,T 10006729
chr7 105706069 rs374714731 G T 10006730
chr7 105706078 rs368284524 C T 10006731
chr7 105706084 rs73414213 C T 10006732
chr7 105706153 rs111416071 TG T 10006733
chr7 105706153 rs553788706 T TG 10006734
chr7 105706153 rs55773024 T TG 10006735
chr7 105706155 rs569154421 G A,C,T 10006736
chr7 105706287 rs76771767 A G 10006737
chr7 105706311 rs78402621 G A 10006738
chr7 105706403 rs17152528 G A,T 10006739
chr7 105706462 rs73414214 C A 10006740
chr7 105706468 rs111512229 A G 10006741
chr7 105706618 rs371623089 A G 10006742
chr7 105706642 rs114186519 A C 10006743
Genes possibly regulated by POLR2A[chr7:105705241-105706688]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by POLR2A[chr7:105705241-105706688]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results