Chrom Start End Enhancer ID Tissues that enhancer appears More
chr18 55393179 55398755 enh32730

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr18 55398046 rs35109606 TATATATATATATATATATATACACAC T 5277516
chr18 55398046 rs66512878 TATATATATATATATATATATACACAC T 5277517

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results