Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 69842245 69860115 enh4119

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 69846970 rs530703006 C T 4508199
chr16 69846974 rs553965758 T TTCATGTATGCGTGTGTGTAG 4508200

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results