EnhancerDB
  1. Home
  2. TFBS
  3. TBX2[chr14:50444660-50444671]
Chromosome characteristics of TBX2[chr14:50444660-50444671]
Back to top
Enhancers possibly regulated by TBX2[chr14:50444660-50444671]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 50424415 50472755 enh3175
Bone Marrow (K562) Brain (SK-N-MC) Liver Astrocyte Colon (HCT116) Adrenal Blood (Karpas-422) Pancreas Uterus Blood (T-cell) Epithelial (MCF-7) Stomach Skin (Keratinocyte) Brain (SK-N-SH) Bone (Osteoblast) Blood (OCI-LY7) Thyroid Peripheral Blood (MM.1S) Pancreas (Panc1) Thymus Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Blood (GM12878) Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Muscle (A673) Heart
SNP sites on TBX2[chr14:50444660-50444671]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 50444660 rs368335860 T TAAGGTGACAAAAGACAATACCCATCCTA 3527405
chr14 50444660 rs573692873 T TAAGGTGACAAAAGACAATACCCATCCTA 3527406
chr14 50444662 rs78625309 A T 3527407
Genes possibly regulated by TBX2[chr14:50444660-50444671]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by TBX2[chr14:50444660-50444671]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results