Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 52813105 52825015 enh30879

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 52824601 rs199685831 ATATATACACATAAATTATATG A 3542354
chr14 52824601 rs58887037 ATATATACACATAAATTATATG A 3542355

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results