EnhancerDB
  1. Home
  2. TFBS
  3. FOXI1[chr14:65715928-65715940]
Chromosome characteristics of FOXI1[chr14:65715928-65715940]
Back to top
Enhancers possibly regulated by FOXI1[chr14:65715928-65715940]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 65714905 65738715 enh15689
Skin (Keratinocyte) Prostate (PC-3) Liver (HepG2) Cervix (HeLa-S3) Brain (SK-N-SH) Large Intestine Astrocyte Bone (Osteoblast) Stomach Placenta Colon (HCT116) Thyroid Lung (PC-9) Pancreas Neural Stem Cells (H9) Epithelial (MCF-7)
SNP sites on FOXI1[chr14:65715928-65715940]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 65715928 rs140322524 CACATAAATAAATAAATAAATAAATAAAT C 3610522
chr14 65715928 rs776090693 CACATAAATAAATAAATAAATAAATAAAT C 3610523
chr14 65715930 rs12436686 C A 3610524
Genes possibly regulated by FOXI1[chr14:65715928-65715940]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXI1[chr14:65715928-65715940]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results