| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr14 | 67891709 | 67913449 | enh15695 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr14 | 67908398 | rs140773836 | GGGCGGGCCTCATCCAATCTGTTGGAGGTGAGGCCTGAATAGAACC | G | 3619083 | |
| chr14 | 67908398 | rs370290597 | GGGCGGGCCTCATCCAATCTGTTGGAGGTGAGGCCTGAATAGAACC | G | 3619084 | |
| chr14 | 67908401 | rs113075239 | C | T | 3619085 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|