EnhancerDB
  1. Home
  2. TFBS
  3. ZNF263[chr14:69035508-69035529]
Chromosome characteristics of ZNF263[chr14:69035508-69035529]
Back to top
Enhancers possibly regulated by ZNF263[chr14:69035508-69035529]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 69028205 69059215 enh15717
Brain (SK-N-MC) Astrocyte Colon (HCT116) Pancreas Uterus Epithelial (MCF-7) Kidney Skin (Keratinocyte) Stomach Brain (SK-N-SH) Ovary Bone (Osteoblast) Thyroid Prostate (PC-3) Cervix (HeLa-S3) Large Intestine Esophagus Placenta Lung (PC-9) Breast Muscle (Myoblast) Muscle (Myotube) Liver (HepG2) Prostate (RWPE1) Lung Muscle (A673) Heart
SNP sites on ZNF263[chr14:69035508-69035529]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 69035508 rs369167748 CCTTTCTTCTTCCTCTGCCCTCT C 3626515
chr14 69035508 rs573614076 CCTTTCTTCTTCCTCTGCCCTCT C 3626516
chr14 69035525 rs549302674 C T 3626517
Genes possibly regulated by ZNF263[chr14:69035508-69035529]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by ZNF263[chr14:69035508-69035529]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results