Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 74219350 rs17091106 G A 3657078
chr14 74219353 rs554327110 A ACAGACAGACGCCCGTTTGACTC 3657079

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results