EnhancerDB
  1. Home
  2. TFBS
  3. RFX5[chr14:77591492-77591507]
Chromosome characteristics of RFX5[chr14:77591492-77591507]
Back to top
Enhancers possibly regulated by RFX5[chr14:77591492-77591507]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 77584190 77597222 enh3338
Cervix (HeLa-S3) Epithelial (MCF-7) Large Intestine Prostate (RWPE1) Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Stomach Peripheral Blood (MM.1S) Uterus Blood (Karpas-422) Lung (PC-9) Pancreas Muscle (Myotube) Neural Stem Cells (H9) Thymus Heart
chr14 77591216 77591790 vista18566
VISTA
SNP sites on RFX5[chr14:77591492-77591507]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 77591503 rs536441466 G GGGAGGCCACGCGCGACGGCGTCGCAGCC 3677510
Genes possibly regulated by RFX5[chr14:77591492-77591507]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by RFX5[chr14:77591492-77591507]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results