Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 78101905 78116435 enh31043

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 78109182 rs148371058 CAAATAAATAAATAAATAAAT C 3680247

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results