Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 89800668 89811842 enh15832

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 89801097 rs568814108 TTTGTTTTGAGACAGAATCTTGCTCC T 3717065

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results