Chrom Start End Enhancer ID Tissues that enhancer appears More
chr14 95606583 95618055 enh58611

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 95615309 rs540601885 T TTGCCCAGGCCAGAGTGCCATGG 3753353

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr14 95604298 95604319 - hsa-miR-3173-5p MIMAT0019214 95623746 0.916667 0.0 8426 418