Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr14 95964075 rs181511138 T C 3756649
chr14 95964082 rs139139133 AAATGAGCATGACTGCGTTCC A 3756650
chr14 95964082 rs374057988 AAATGAGCATGACTGCGTTCC A 3756651

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results