EnhancerDB
  1. Home
  2. TFBS
  3. SP1[chr16:81868639-81868649]
Chromosome characteristics of SP1[chr16:81868639-81868649]
Back to top
Enhancers possibly regulated by SP1[chr16:81868639-81868649]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr16 81835968 81874694 enh4152
Blood (T-cell) Blood (OCI-LY7) Blood (GM12878) Placenta Colon (HCT116) Uterus Peripheral Blood (MM.1S) Blood (Karpas-422) Neural Stem Cells (H9) Thymus Stomach
SNP sites on SP1[chr16:81868639-81868649]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr16 81868640 rs115563301 G A 4589000
chr16 81868649 rs111518977 GGTGGAGGTACCCAAAGAGGAGGAA G 4589001
chr16 81868649 rs372854680 GGTGGAGGTACCCAAAGAGGAGGAA G 4589002
Genes possibly regulated by SP1[chr16:81868639-81868649]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by SP1[chr16:81868639-81868649]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results